Review



el4 lymphoma cell line  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    ATCC el4 lymphoma cell line
    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or <t>EL4-NP68</t> cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .
    El4 Lymphoma Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1932 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pmc13098610-76-8-12
    Average 97 stars, based on 1932 article reviews
    el4 lymphoma cell line - by Bioz Stars, 2026-09
    97/100 stars

    Images

    1) Product Images from "Transient tumor exposure induces persistent functional defects in memory CD8 + T cells"

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    Journal: iScience

    doi: 10.1016/j.isci.2026.115556

    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .
    Figure Legend Snippet: Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .

    Techniques Used: Generated, Flow Cytometry, Expressing, Infection, Marker, Single Cell

    Tum-CD8 + memory cells express molecules associated with T cell exhaustion Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) The expression of PD-1, TIM-3, CD9, and Gal3 was measured at the surface of CD8 + memory cells at 30 dpi by flow cytometry. (C and D) The expression of Gal3 was measured intracellularly in memory CD8 + T cells at 30 dpi by flow cytometry. (E) At 30 dpi, splenocytes were stimulated with NP68 peptide (10 nM) for 4 h, and the expression of PD-1, TIM-3, or intracellular Gal3 by memory CD8 + T cells was measured by flow cytometry. The statistical significance of differences was determined using the Mann-Whitney test (B and D) or two-way ANOVA (E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent experiments.
    Figure Legend Snippet: Tum-CD8 + memory cells express molecules associated with T cell exhaustion Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) The expression of PD-1, TIM-3, CD9, and Gal3 was measured at the surface of CD8 + memory cells at 30 dpi by flow cytometry. (C and D) The expression of Gal3 was measured intracellularly in memory CD8 + T cells at 30 dpi by flow cytometry. (E) At 30 dpi, splenocytes were stimulated with NP68 peptide (10 nM) for 4 h, and the expression of PD-1, TIM-3, or intracellular Gal3 by memory CD8 + T cells was measured by flow cytometry. The statistical significance of differences was determined using the Mann-Whitney test (B and D) or two-way ANOVA (E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent experiments.

    Techniques Used: Expressing, Flow Cytometry, MANN-WHITNEY

    Tum-CD8 + memory cells display altered cytokine production but not cytotoxic capacities compared to Vir-CD8 + memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence of GolgiStop. The production of IFNγ, TNF, and IL-2 was measured by flow cytometry and expressed in % of total F5 (A) or MFI within the cytokine+ cells (B). (C and D) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence (cytokines) or absence (CD69) of GolgiStop. The production of IFNγ and TNF and the upregulation of CD69 were measured by flow cytometry over time and expressed in % (C) or MFI (D). (E) The production of IFNγ was measured in supernatant after 4 or 24h of stimulation. (F and G) At 30 dpi, F5 memory cells were restimulated with various doses of NP68 for 4h in the presence of GolgiStop, and the production of IFNγ and TNF was measured by flow cytometry (F). EC 50 was determined (G). (H and I) Splenocytes were incubated with NP68 (10 nM) or control medium for 2h and labeled with CTV or CFSE, respectively. A 1:1 ratio of NP68-loaded splenocytes: control splenocytes (2.10 6 cells) was injected i.v. in Tum-CD8 + or Vir-CD8 + challenged mice at the memory stage. Representative histograms depicting control and CTV-labeled NP68-loaded splenocytes are shown (H). The percentage of NP68-loaded splenocytes killed was evaluated at 6-, 16-, or 44-h post-transfer (I). (J)Total CD8 + enriched from Tum-CD8 + or Vir-CD8 + challenged mice were labeled with CTV and stimulated with NP68-loaded DCs (1:1 ratio) for 4 days in the presence of IL-2. The expansion index of F5 cells was determined after 4 days. The statistical significance of differences was determined using 2-way ANOVA (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent (A–G) or 1 (H–J) experiment(s).
    Figure Legend Snippet: Tum-CD8 + memory cells display altered cytokine production but not cytotoxic capacities compared to Vir-CD8 + memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence of GolgiStop. The production of IFNγ, TNF, and IL-2 was measured by flow cytometry and expressed in % of total F5 (A) or MFI within the cytokine+ cells (B). (C and D) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence (cytokines) or absence (CD69) of GolgiStop. The production of IFNγ and TNF and the upregulation of CD69 were measured by flow cytometry over time and expressed in % (C) or MFI (D). (E) The production of IFNγ was measured in supernatant after 4 or 24h of stimulation. (F and G) At 30 dpi, F5 memory cells were restimulated with various doses of NP68 for 4h in the presence of GolgiStop, and the production of IFNγ and TNF was measured by flow cytometry (F). EC 50 was determined (G). (H and I) Splenocytes were incubated with NP68 (10 nM) or control medium for 2h and labeled with CTV or CFSE, respectively. A 1:1 ratio of NP68-loaded splenocytes: control splenocytes (2.10 6 cells) was injected i.v. in Tum-CD8 + or Vir-CD8 + challenged mice at the memory stage. Representative histograms depicting control and CTV-labeled NP68-loaded splenocytes are shown (H). The percentage of NP68-loaded splenocytes killed was evaluated at 6-, 16-, or 44-h post-transfer (I). (J)Total CD8 + enriched from Tum-CD8 + or Vir-CD8 + challenged mice were labeled with CTV and stimulated with NP68-loaded DCs (1:1 ratio) for 4 days in the presence of IL-2. The expansion index of F5 cells was determined after 4 days. The statistical significance of differences was determined using 2-way ANOVA (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent (A–G) or 1 (H–J) experiment(s).

    Techniques Used: Flow Cytometry, Incubation, Control, Labeling, Injection

    A transient tumoral challenge is sufficient to alter the protection capacity of F5 memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A–D) At 30 dpi, Vir- or Tum-challenged mice were infected with VV-NP68 (2.10 5 pfu). Six days after infection, mice received an i.v. injection of anti-CD8 antibody, and the proportion of cells within the tissue and the vasculature of the lung was determined (A). The proportion of memory CD8 + T cells in the lung tissue among all memory CD8 + T cells was determined (B). The expression of CD49a (C) and CD49d (D) was measured on memory CD8 + T cells within the lung tissue and vasculature. (E) At 30 dpi, Vir- or Tum-challenged mice were infected with Flu-NP68 (5.10 4 TCID50), and the weight loss was followed for 6 days. (F) At 30 dpi, Vir-CD8 + and Tum-CD8 + memory cells were FACS-sorted and transferred into B6 host (1,2.10 5 cells, i.v. route). One day after transfer, mice received a lethal dose of Flu-NP68 (2.10 6 TCID 50), and survival was followed for 10 days. The statistical significance of differences was determined with 1-way (B) or 2-way (C–E) ANOVA test (∗ p > 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001), or log rank test (F). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 (A–D, and G) or 1 (E and F) experiment(s).
    Figure Legend Snippet: A transient tumoral challenge is sufficient to alter the protection capacity of F5 memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A–D) At 30 dpi, Vir- or Tum-challenged mice were infected with VV-NP68 (2.10 5 pfu). Six days after infection, mice received an i.v. injection of anti-CD8 antibody, and the proportion of cells within the tissue and the vasculature of the lung was determined (A). The proportion of memory CD8 + T cells in the lung tissue among all memory CD8 + T cells was determined (B). The expression of CD49a (C) and CD49d (D) was measured on memory CD8 + T cells within the lung tissue and vasculature. (E) At 30 dpi, Vir- or Tum-challenged mice were infected with Flu-NP68 (5.10 4 TCID50), and the weight loss was followed for 6 days. (F) At 30 dpi, Vir-CD8 + and Tum-CD8 + memory cells were FACS-sorted and transferred into B6 host (1,2.10 5 cells, i.v. route). One day after transfer, mice received a lethal dose of Flu-NP68 (2.10 6 TCID 50), and survival was followed for 10 days. The statistical significance of differences was determined with 1-way (B) or 2-way (C–E) ANOVA test (∗ p > 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001), or log rank test (F). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 (A–D, and G) or 1 (E and F) experiment(s).

    Techniques Used: Infection, Injection, Expressing

    Phenotype and cytokine production capacity of F5 memory cells is conserved after homologous or heterologous recall (A) Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). At 26 dpi, mice received a second immunization with VV-NP68 or EL4-NP68. (B) Thirty-one days post-recall, the number of F5 cells was measured in the spleen. (C) The expression of CD9, CD43, CD49a, and CD49d was measured on F5 memory cells 31 days after recall by flow cytometry. (D and E) Splenocytes were stimulated with NP68 (10 nM) for 4h in the presence (D) or absence (E) of GolgiStop. (D) The production of IFNγ, TFNα, and IL-2 was measured by flow cytometry. (E) The expression of PD-1 and TIM3 on F5 memory cells was determined in the spleen. The statistical significance of differences was determined with 1-way (B and C) or 2-way (D and E) ANOVA test (∗ p > 0.05, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 independent experiments.
    Figure Legend Snippet: Phenotype and cytokine production capacity of F5 memory cells is conserved after homologous or heterologous recall (A) Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). At 26 dpi, mice received a second immunization with VV-NP68 or EL4-NP68. (B) Thirty-one days post-recall, the number of F5 cells was measured in the spleen. (C) The expression of CD9, CD43, CD49a, and CD49d was measured on F5 memory cells 31 days after recall by flow cytometry. (D and E) Splenocytes were stimulated with NP68 (10 nM) for 4h in the presence (D) or absence (E) of GolgiStop. (D) The production of IFNγ, TFNα, and IL-2 was measured by flow cytometry. (E) The expression of PD-1 and TIM3 on F5 memory cells was determined in the spleen. The statistical significance of differences was determined with 1-way (B and C) or 2-way (D and E) ANOVA test (∗ p > 0.05, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 independent experiments.

    Techniques Used: Expressing, Flow Cytometry

    Related Articles

    Modification:

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8+ T cells
    Article Snippet: Bruno Lina’s laboratory at the Univer- site ́ de Lyon Modified from the A/WSN/33 H1N1 strain Biological samples Chemicals, peptides, and recombinant proteins DMEM Thermo Fischer Scien- tific Cat#61965-026 Sodium pyruvate (100mM) Thermo Fischer Scien- tific Cat#11360-039rc HEPES (1M) Thermo Fischer Scien- tific Cat#15630-056 Gentamicin (50 mg/mL) Thermo Fischer Scien- tific Cat#15750-037 Beta-mercaptoethanol Thermo Fischer Scien- tific Cat#31350-010 DPBS Thermo Fischer Scien- tific Cat#14190-094 FBS Biowest Cat#S1810-500 (Lot#S13439S1810) efluor780-coupled Fixable Viability Dye Invitrogen Cat#65-0865-18 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat#C34554 CellTrace Violet Cell Proliferation Kit Invitrogen Cat#C34557 Jo urn al Pr e-p roo f 20 GolgiStopTM WatersTM Biosciences Cat#554724 Flow-count fluorospheres Beckman Coulter Cat#7547053 NP68 (ASNENMDAM) Proteogenix N/A CpG ODN 1826 InvivoGen tlrl-1826 human Flt3l Amgen N/A RNaseOut Thermo Fischer Scien- tific Cat#10777019 Random primers Thermo Fischer Scien- tific Cat#N8080127 dNTPs Thermo Fischer Scien- tific Cat#R0192 Superscript II Thermo Fischer Scien- tific Cat#18064014 DTT Thermo Fischer Scien- tific Cat#18064014 MgCl2 Sigma Cat# M1028- 10X1ML KAPA Hifi HotStart Ready Mix KAPA Biosystem Cat#KK2602 Agencourt AMPure XP Beckman Cat# A63880 Nextera XT DNA sample preparation kit Illumina Cat#FC-131- 1096 Nextera XT 96-index kit Illumina Cat#FC-131- 1002 Critical commercial assays IFN-g ELISA MAXTM standard Set mouse kit Biolegend Cat#130-104-075 RRID:AB_2893366 Lung Dissociation kit Miltenyi Biotech Cat# 130-095- 927 RRID:SCR_0202 86 CD8a+ T cell isolation kit Miltenyi Biotec Cat#130-104-075 Foxp3/Transcription Factor Staining Buffer Set kit eBioscience Cat#00-5523-00 Cytofix/Cytoperm WatersTM Biosciences Cat#554714 RRID: AB_2869008 Flow-count fluorospheres Beckman Coulter Cat#7547053 NucleoSpin Tissue kit Macherey Nagel 740952.50 Jo urn l P re- pro of 21 Platinum® SYBR® Green qPCR SuperMix- UDG with ROX Thermo Fischer Scien- tific 11744100 DNA high sensitivity D1000 ScreenTape Agilent Cat#5067-5584 Deposited data Raw and analyzed data This paper GSE283102 Experimental models: Cell lines EL4-NP68 Dr. T.N.M. .. Schuma- cher Modified from EL4 lymphoma cell line (ATCC" TIB-39") Experimental models: Organisms/strains C57Bl6/J Charles River MGI:3028467 F5 x CD45.1 (B6-Ptprcem(K302E)Jmar/J-Tg(CD2- TcraF5,CD2-TcrbF5)1Kio/Jmar) This paper RRID:IMSR_EM:155 72 Oligonucleotides VV-HA-Forward (CATCATCTGGAATTGTCACTACTAAA) Sigma N/A VV-HA-Reverse (ACGGCCGACATATAAT- TAATGC) Sigma N/A HPRT-Forward (AAAGACTTGCTCGAGATG) Sigma N/A HPRT-Reverse (TAATGTAAT- CCAGCAGGTC) Sigma N/A Recombinant DNA Software and algorithms BD FACSDiva (v8.0) software WatersTM Biosciences Flowjo (v10.8.0) WatersTM Biosciences RRID:SCR_0085 20 Prism (v10.6.1) Graphpad software N/A ClusterProfiler https://gi- thub.com/YuLabSMU/clusterPro- fi- lerRRID:SCR_01 6884 FastQC https://github.com/s- andrews/FastQC Jo urn al Pr e-p roo f 22 Trim Galore https://gi- thub.com/FelixKrue- ger/TrimGalore limma Ritchie et al., 201563 https://bioconduc- tor.org/packages/release/bioc/html/limm a.html tximport Soneson et al., 201558 github.com/thelove- lab/tximport Salmon https://gi- thub.com/COM- BINE-lab/salmon RRID:SCR_0170 36 Scone Cole et al., 201959 https://gi- thub.com/Yose- fLab/scone SCnorm Bacher et al., 201760 https://gi- thub.com/rhonda- bacher/SCnorm SCRAN Lun, et al., 201661 https://gi- thub.com/elswob/ SCRAN RRID:SCR_0169 44 Seurat v4 Hao, et al., 202162 https://sati- jalab.org/seurat/ Other EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS 515 Animal studies 516 B6 (C57BL/6J, RRID:MGI:3028467) mice were purchased from Charles River Labor-517 atories. ..

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells
    Article Snippet: .. EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”). ..

    Recombinant:

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8+ T cells
    Article Snippet: Bruno Lina’s laboratory at the Univer- site ́ de Lyon Modified from the A/WSN/33 H1N1 strain Biological samples Chemicals, peptides, and recombinant proteins DMEM Thermo Fischer Scien- tific Cat#61965-026 Sodium pyruvate (100mM) Thermo Fischer Scien- tific Cat#11360-039rc HEPES (1M) Thermo Fischer Scien- tific Cat#15630-056 Gentamicin (50 mg/mL) Thermo Fischer Scien- tific Cat#15750-037 Beta-mercaptoethanol Thermo Fischer Scien- tific Cat#31350-010 DPBS Thermo Fischer Scien- tific Cat#14190-094 FBS Biowest Cat#S1810-500 (Lot#S13439S1810) efluor780-coupled Fixable Viability Dye Invitrogen Cat#65-0865-18 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat#C34554 CellTrace Violet Cell Proliferation Kit Invitrogen Cat#C34557 Jo urn al Pr e-p roo f 20 GolgiStopTM WatersTM Biosciences Cat#554724 Flow-count fluorospheres Beckman Coulter Cat#7547053 NP68 (ASNENMDAM) Proteogenix N/A CpG ODN 1826 InvivoGen tlrl-1826 human Flt3l Amgen N/A RNaseOut Thermo Fischer Scien- tific Cat#10777019 Random primers Thermo Fischer Scien- tific Cat#N8080127 dNTPs Thermo Fischer Scien- tific Cat#R0192 Superscript II Thermo Fischer Scien- tific Cat#18064014 DTT Thermo Fischer Scien- tific Cat#18064014 MgCl2 Sigma Cat# M1028- 10X1ML KAPA Hifi HotStart Ready Mix KAPA Biosystem Cat#KK2602 Agencourt AMPure XP Beckman Cat# A63880 Nextera XT DNA sample preparation kit Illumina Cat#FC-131- 1096 Nextera XT 96-index kit Illumina Cat#FC-131- 1002 Critical commercial assays IFN-g ELISA MAXTM standard Set mouse kit Biolegend Cat#130-104-075 RRID:AB_2893366 Lung Dissociation kit Miltenyi Biotech Cat# 130-095- 927 RRID:SCR_0202 86 CD8a+ T cell isolation kit Miltenyi Biotec Cat#130-104-075 Foxp3/Transcription Factor Staining Buffer Set kit eBioscience Cat#00-5523-00 Cytofix/Cytoperm WatersTM Biosciences Cat#554714 RRID: AB_2869008 Flow-count fluorospheres Beckman Coulter Cat#7547053 NucleoSpin Tissue kit Macherey Nagel 740952.50 Jo urn l P re- pro of 21 Platinum® SYBR® Green qPCR SuperMix- UDG with ROX Thermo Fischer Scien- tific 11744100 DNA high sensitivity D1000 ScreenTape Agilent Cat#5067-5584 Deposited data Raw and analyzed data This paper GSE283102 Experimental models: Cell lines EL4-NP68 Dr. T.N.M. .. Schuma- cher Modified from EL4 lymphoma cell line (ATCC" TIB-39") Experimental models: Organisms/strains C57Bl6/J Charles River MGI:3028467 F5 x CD45.1 (B6-Ptprcem(K302E)Jmar/J-Tg(CD2- TcraF5,CD2-TcrbF5)1Kio/Jmar) This paper RRID:IMSR_EM:155 72 Oligonucleotides VV-HA-Forward (CATCATCTGGAATTGTCACTACTAAA) Sigma N/A VV-HA-Reverse (ACGGCCGACATATAAT- TAATGC) Sigma N/A HPRT-Forward (AAAGACTTGCTCGAGATG) Sigma N/A HPRT-Reverse (TAATGTAAT- CCAGCAGGTC) Sigma N/A Recombinant DNA Software and algorithms BD FACSDiva (v8.0) software WatersTM Biosciences Flowjo (v10.8.0) WatersTM Biosciences RRID:SCR_0085 20 Prism (v10.6.1) Graphpad software N/A ClusterProfiler https://gi- thub.com/YuLabSMU/clusterPro- fi- lerRRID:SCR_01 6884 FastQC https://github.com/s- andrews/FastQC Jo urn al Pr e-p roo f 22 Trim Galore https://gi- thub.com/FelixKrue- ger/TrimGalore limma Ritchie et al., 201563 https://bioconduc- tor.org/packages/release/bioc/html/limm a.html tximport Soneson et al., 201558 github.com/thelove- lab/tximport Salmon https://gi- thub.com/COM- BINE-lab/salmon RRID:SCR_0170 36 Scone Cole et al., 201959 https://gi- thub.com/Yose- fLab/scone SCnorm Bacher et al., 201760 https://gi- thub.com/rhonda- bacher/SCnorm SCRAN Lun, et al., 201661 https://gi- thub.com/elswob/ SCRAN RRID:SCR_0169 44 Seurat v4 Hao, et al., 202162 https://sati- jalab.org/seurat/ Other EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS 515 Animal studies 516 B6 (C57BL/6J, RRID:MGI:3028467) mice were purchased from Charles River Labor-517 atories. ..

    Software:

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8+ T cells
    Article Snippet: Bruno Lina’s laboratory at the Univer- site ́ de Lyon Modified from the A/WSN/33 H1N1 strain Biological samples Chemicals, peptides, and recombinant proteins DMEM Thermo Fischer Scien- tific Cat#61965-026 Sodium pyruvate (100mM) Thermo Fischer Scien- tific Cat#11360-039rc HEPES (1M) Thermo Fischer Scien- tific Cat#15630-056 Gentamicin (50 mg/mL) Thermo Fischer Scien- tific Cat#15750-037 Beta-mercaptoethanol Thermo Fischer Scien- tific Cat#31350-010 DPBS Thermo Fischer Scien- tific Cat#14190-094 FBS Biowest Cat#S1810-500 (Lot#S13439S1810) efluor780-coupled Fixable Viability Dye Invitrogen Cat#65-0865-18 CellTrace CFSE Cell Proliferation Kit Invitrogen Cat#C34554 CellTrace Violet Cell Proliferation Kit Invitrogen Cat#C34557 Jo urn al Pr e-p roo f 20 GolgiStopTM WatersTM Biosciences Cat#554724 Flow-count fluorospheres Beckman Coulter Cat#7547053 NP68 (ASNENMDAM) Proteogenix N/A CpG ODN 1826 InvivoGen tlrl-1826 human Flt3l Amgen N/A RNaseOut Thermo Fischer Scien- tific Cat#10777019 Random primers Thermo Fischer Scien- tific Cat#N8080127 dNTPs Thermo Fischer Scien- tific Cat#R0192 Superscript II Thermo Fischer Scien- tific Cat#18064014 DTT Thermo Fischer Scien- tific Cat#18064014 MgCl2 Sigma Cat# M1028- 10X1ML KAPA Hifi HotStart Ready Mix KAPA Biosystem Cat#KK2602 Agencourt AMPure XP Beckman Cat# A63880 Nextera XT DNA sample preparation kit Illumina Cat#FC-131- 1096 Nextera XT 96-index kit Illumina Cat#FC-131- 1002 Critical commercial assays IFN-g ELISA MAXTM standard Set mouse kit Biolegend Cat#130-104-075 RRID:AB_2893366 Lung Dissociation kit Miltenyi Biotech Cat# 130-095- 927 RRID:SCR_0202 86 CD8a+ T cell isolation kit Miltenyi Biotec Cat#130-104-075 Foxp3/Transcription Factor Staining Buffer Set kit eBioscience Cat#00-5523-00 Cytofix/Cytoperm WatersTM Biosciences Cat#554714 RRID: AB_2869008 Flow-count fluorospheres Beckman Coulter Cat#7547053 NucleoSpin Tissue kit Macherey Nagel 740952.50 Jo urn l P re- pro of 21 Platinum® SYBR® Green qPCR SuperMix- UDG with ROX Thermo Fischer Scien- tific 11744100 DNA high sensitivity D1000 ScreenTape Agilent Cat#5067-5584 Deposited data Raw and analyzed data This paper GSE283102 Experimental models: Cell lines EL4-NP68 Dr. T.N.M. .. Schuma- cher Modified from EL4 lymphoma cell line (ATCC" TIB-39") Experimental models: Organisms/strains C57Bl6/J Charles River MGI:3028467 F5 x CD45.1 (B6-Ptprcem(K302E)Jmar/J-Tg(CD2- TcraF5,CD2-TcrbF5)1Kio/Jmar) This paper RRID:IMSR_EM:155 72 Oligonucleotides VV-HA-Forward (CATCATCTGGAATTGTCACTACTAAA) Sigma N/A VV-HA-Reverse (ACGGCCGACATATAAT- TAATGC) Sigma N/A HPRT-Forward (AAAGACTTGCTCGAGATG) Sigma N/A HPRT-Reverse (TAATGTAAT- CCAGCAGGTC) Sigma N/A Recombinant DNA Software and algorithms BD FACSDiva (v8.0) software WatersTM Biosciences Flowjo (v10.8.0) WatersTM Biosciences RRID:SCR_0085 20 Prism (v10.6.1) Graphpad software N/A ClusterProfiler https://gi- thub.com/YuLabSMU/clusterPro- fi- lerRRID:SCR_01 6884 FastQC https://github.com/s- andrews/FastQC Jo urn al Pr e-p roo f 22 Trim Galore https://gi- thub.com/FelixKrue- ger/TrimGalore limma Ritchie et al., 201563 https://bioconduc- tor.org/packages/release/bioc/html/limm a.html tximport Soneson et al., 201558 github.com/thelove- lab/tximport Salmon https://gi- thub.com/COM- BINE-lab/salmon RRID:SCR_0170 36 Scone Cole et al., 201959 https://gi- thub.com/Yose- fLab/scone SCnorm Bacher et al., 201760 https://gi- thub.com/rhonda- bacher/SCnorm SCRAN Lun, et al., 201661 https://gi- thub.com/elswob/ SCRAN RRID:SCR_0169 44 Seurat v4 Hao, et al., 202162 https://sati- jalab.org/seurat/ Other EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS 515 Animal studies 516 B6 (C57BL/6J, RRID:MGI:3028467) mice were purchased from Charles River Labor-517 atories. ..

    other:

    Article Title: Exogenous IL-2 delays memory precursors generation and is essential for enhancing memory cells effector functions
    Article Snippet: EL4 lymphoma cell line (ATCC® TIB-39TM) , ATCC , Cat#TIB-39.

    Cell Culture:

    Article Title: Exogenous IL-2 delays memory precursors generation and is essential for enhancing memory cells effector functions
    Article Snippet: EL4 cells were stained with Zombie Green Fixable Viability Dye (Biolegend) and survival was measured by flow cytometry. .. The EL4 lymphoma cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA) and cultured in complete DMEM medium. .. Statistical analyses were performed using Graph-pad software Prism 5.

    Stable Transfection:

    Article Title: Tumor cell derived osteopontin and prostaglandin E2 synergistically promote the expansion of myeloid derived suppressor cells during the tumor immune escape phase.
    Article Snippet: PGE2 and recombinant mouse osteopontin were purchased from Sigma (Sigma-Merck, Darmstadt, Germany) and R&D Systems (Minneapolis, USA), respectively. .. EL4 lymphoma cell line (referred to hereafter as EL4luc2 cells) was obtained from the American Type Culture Collection (Manassas, VA, USA) and were stably engineered to express the gene, luc2 (PerkinElmer, MA, USA). ..



    Similar Products

    97
    ATCC el4 lymphoma cell line
    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or <t>EL4-NP68</t> cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .
    El4 Lymphoma Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pmc13098610-76-8-12
    Average 97 stars, based on 1 article reviews
    el4 lymphoma cell line - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    ATCC el4 mouse lymphoma cell lines
    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or <t>EL4-NP68</t> cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .
    El4 Mouse Lymphoma Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pm41445186-153-4-23
    Average 97 stars, based on 1 article reviews
    el4 mouse lymphoma cell lines - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    ATCC cell lines murine t lymphoma el4 cells atcc
    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or <t>EL4-NP68</t> cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .
    Cell Lines Murine T Lymphoma El4 Cells Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pm41763215-258-44-51
    Average 97 stars, based on 1 article reviews
    cell lines murine t lymphoma el4 cells atcc - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    ATCC el4 murine t cell lymphoma line tib 39
    Analysis of Eomes expression in CD8 + T cells isolated from the spleens of uninfected WT and Ikzf3 -/- mice. a Representative flow contour plots depicting expression of Eomes in WT and Ikzf3 -/- CD8 + T cells; and b respective bar graphs showing percent (%) of Eomes + and numbers of Eomes-expressing CD8 + T cells (# counts, normalized to 6 × 10 5 events). c Representative histogram overlay for Eomes expression and associated data showing differences in median fluorescence intensity (MFI) fold change relative to WT control. For ( a – c ), data shown for 4 independent experiments, n = 14/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. d Representative flow plots and e associated bar graphs showing percent (%) of CD122 + and numbers of CD122-expressing CD8 + T cells (#: counts, normalized to 6 × 10 5 events), Data shown for 3 independent experiments, n = 11/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. f Analysis of publicly available Aiolos Chromatin Immunoprecipitation (ChIP)-Seq data (GSM5106065) and STAT5b ChIP-Seq data (GSM7887512) showing enrichment of Aiolos and STAT5b at the Eomes promoter region. Sequencing tracks were viewed using Integrative Genomics Viewer. The gene region cloned into a reporter vector for Eomes promoter activity is indicated. g , h <t>EL4</t> T cells were transfected with an Eomes promoter-reporter construct in conjunction with vectors for Aiolos, Aiolos DNA binding mutant (Aiolos DBM) , constitutively active STAT5b (STAT5b CA ), or empty vector control. As a control for transfection efficiency, cells were concurrently transfected with SV40- Renilla , and luciferase activity was used as a readout for promoter activity. Luciferase promoter-reporter values were normalized to SV40- Renilla control and presented as relative to the empty vector. Immunoblot analysis of the indicated proteins confirming the overexpression of respective vectors. β-actin was used as a loading control. Data are representative of 4 independent experiments, n = 4/condition, mean ± SEM, one-way ANOVA with Tukey’s multiple comparisons test, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Source data are provided as a file.
    El4 Murine T Cell Lymphoma Line Tib 39, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pmc12827986-238-1-21
    Average 97 stars, based on 1 article reviews
    el4 murine t cell lymphoma line tib 39 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    ATCC el4 murine lymphoma cell lines
    Analysis of Eomes expression in CD8 + T cells isolated from the spleens of uninfected WT and Ikzf3 -/- mice. a Representative flow contour plots depicting expression of Eomes in WT and Ikzf3 -/- CD8 + T cells; and b respective bar graphs showing percent (%) of Eomes + and numbers of Eomes-expressing CD8 + T cells (# counts, normalized to 6 × 10 5 events). c Representative histogram overlay for Eomes expression and associated data showing differences in median fluorescence intensity (MFI) fold change relative to WT control. For ( a – c ), data shown for 4 independent experiments, n = 14/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. d Representative flow plots and e associated bar graphs showing percent (%) of CD122 + and numbers of CD122-expressing CD8 + T cells (#: counts, normalized to 6 × 10 5 events), Data shown for 3 independent experiments, n = 11/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. f Analysis of publicly available Aiolos Chromatin Immunoprecipitation (ChIP)-Seq data (GSM5106065) and STAT5b ChIP-Seq data (GSM7887512) showing enrichment of Aiolos and STAT5b at the Eomes promoter region. Sequencing tracks were viewed using Integrative Genomics Viewer. The gene region cloned into a reporter vector for Eomes promoter activity is indicated. g , h <t>EL4</t> T cells were transfected with an Eomes promoter-reporter construct in conjunction with vectors for Aiolos, Aiolos DNA binding mutant (Aiolos DBM) , constitutively active STAT5b (STAT5b CA ), or empty vector control. As a control for transfection efficiency, cells were concurrently transfected with SV40- Renilla , and luciferase activity was used as a readout for promoter activity. Luciferase promoter-reporter values were normalized to SV40- Renilla control and presented as relative to the empty vector. Immunoblot analysis of the indicated proteins confirming the overexpression of respective vectors. β-actin was used as a loading control. Data are representative of 4 independent experiments, n = 4/condition, mean ± SEM, one-way ANOVA with Tukey’s multiple comparisons test, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Source data are provided as a file.
    El4 Murine Lymphoma Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/us12473307-218-0-8
    Average 97 stars, based on 1 article reviews
    el4 murine lymphoma cell lines - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    ATCC mouse lymphoma cell line el4 expressing mouse mhc
    A ) CD45.1 mice were adoptively transferred with 1–2 × 10 5 gp100+ CD8 T cells co-transduced −CA-STAT5 or +CA-STAT5 and vaccinated with TriVax on the following day (n=3 mice/group). 7 days later, the mice were sacrificed and splenocytes were harvested for cytokine analysis. B ) Representative images demonstrating the percentage of splenocytes producing IFNγ, TNFα, and Granzyme B (GzmB) in response to gp100 peptide stimulation compared to irrelevant (ova) peptide. The number of cells from each group incubated with peptide were normalized based on tetramer staining so that each well had the same number of gp100 tetramer+ T cells. Summary of results depicted in bar graph. C ) Measurement of IFNγ production in an ELISpot assay. The number of CD8 T cells in each group per well were unsorted and normalized to the same number of total gp100 tetramer+ CD8 T cells so that each well had the same number of gp100+ CD8 T cells. D ) CD8 T cells isolated from the experiments described in A were co-cultured with <t>EL4,</t> EL4 pulsed with gp100 short peptide (positive control), or B16F10 tumor cells. Supernatant was harvested after overnight culture from triplicate wells and evaluated for IFNγ production using ELISA. E ) Cytotoxic killing potential was measured by co-culturing +CA-STAT5 or −CA-STAT5 CD8 T cells with CFSE-labeled EL4, EL4 pulsed with gp100 short peptide, or B16F10 at an effector-to-target ratio (gp100 tetramer+ CD8 T cells to B16 melanoma) of 10:1. Summary graphs of at least two independent experiments from each figure is shown.
    Mouse Lymphoma Cell Line El4 Expressing Mouse Mhc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4/pmc11879759-40-0-13
    Average 97 stars, based on 1 article reviews
    mouse lymphoma cell line el4 expressing mouse mhc - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    ATCC mouse lymphoma cell line
    a , b The log2 ratio of gene abundance between the memory and naïve OT-I <t>cells,</t> <t>line</t> plot with genes ranked according to increasing log2 ratios. Based on data from Fig. ( a ) and GEO dataset GSE15907 ( b ). c H2A.Z expression was analyzed in naïve (CD62L hi CD44 lo ) and memory (CD127 hi KLRG1 lo ) OT-I cells ( n = 5 <t>mice</t> per group). Values denote geometric mean fluorescence intensity (gMFI). d Experiment setup. CD45 congenically distinct naïve OT-I cells from wild-type (WT) and GzmB-Cre H2A.Z f/f (cKO) OT-I mice were mixed at a 1:1 ratio and co-transferred into recipients. On the next day, these mice were infected with LM-OVA. On day 30-45, WT and cKO memory OT-I cells were sorted and re-mixed at a 1:1 ratio (1.5 × 10 4 mixed cells/mice) and co-transferred into congenically marked WT recipients and followed by LM-OVA infection. e At day 7 post-infection, the frequencies of donor cells in the spleen of recipient mice were determined ( n = 10 mice). f Experiment setup. CD45 congenically distinct naïve OT-I cells from WT and Rosa26 cre-ERT2 H2A.Z f/f (icKO) OT-I mice were mixed at a 1:1 ratio and transferred into recipients. On the next day, these mice were infected with LM-OVA. After TAM injection, WT and icKO memory OT-I cells were sorted and re-transferred into congenically marked WT recipients and followed by LM-OVA infection. g , h On day 7 post-infection, the frequencies of donor cells in the blood ( g ) and spleen ( h ) of recipient mice were determined ( n = 10 mice). i , j Splenocytes isolated from recipient mice were stimulated with the OVA 257-264 peptide for 6 h, then cytokine production from OT-I cells was measured. Values denote gMFI ( n = 9 biologically independent samples). Data are representative of two independent experiments in ( c ), three independent experiments in ( e and g – j ). Data are mean ± SD. Statistical analysis was performed using two-tailed unpaired Student’s t test ( c ) or two-tailed paired Student’s t test ( e and g – j ). Source data are provided as a file.
    Mouse Lymphoma Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/el4+lymphoma+cell+line/EL4%3B+Lymphoma%3B+Mouse/pmc12356978-327-1-5
    Average 96 stars, based on 1 article reviews
    mouse lymphoma cell line - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .

    Journal: iScience

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    doi: 10.1016/j.isci.2026.115556

    Figure Lengend Snippet: Phenotypic and transcriptional differences of memory CD8 + T cells generated after a viral or a tumoral challenge Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A) Viral load was measured in the lung by qPCR, or tumor volume (mm 3 ) was assessed by measuring its length, width, and thickness over time. (B) The number of Vir-CD8 + and Tum-CD8 + cells was determined over time in the blood by flow cytometry. (C and D) The expression of Ki67 (C) and Bcl2 (D) by Vir-CD8 + and Tum-CD8 + cells was measured over time in the blood. (E) The phenotype of Vir-CD8 + and Tum-CD8 + cells was analyzed 31 days after infection in the spleen, and the percentages of cells expressing each marker are represented as a heatmap. The statistical significance of differences was determined using a two-way ANOVA (C–E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001). Data are represented as mean ± SD and are representative of 3 independent experiments ( n = 5 to 10 mice per group). (F–I) 60 days after immunization, naive F5 and Vir-CD8 + and Tum-CD8 + cells were single-cell sorted, and stimulated with NP68 peptide (10 nM) for 2 h or left untreated. The transcriptome was analyzed by scRNAseq ( n = 476 cells). (F) Clustering of cells projected on a UMAP colored by populations. (G) Proportion of sorted populations in each cluster. (H and I) Volcano plot of the differentially expressed genes between quiescent (H) or restimulated (I) Vir-CD8 + and Tum-CD8 + .

    Article Snippet: EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”).

    Techniques: Generated, Flow Cytometry, Expressing, Infection, Marker, Single Cell

    Tum-CD8 + memory cells express molecules associated with T cell exhaustion Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) The expression of PD-1, TIM-3, CD9, and Gal3 was measured at the surface of CD8 + memory cells at 30 dpi by flow cytometry. (C and D) The expression of Gal3 was measured intracellularly in memory CD8 + T cells at 30 dpi by flow cytometry. (E) At 30 dpi, splenocytes were stimulated with NP68 peptide (10 nM) for 4 h, and the expression of PD-1, TIM-3, or intracellular Gal3 by memory CD8 + T cells was measured by flow cytometry. The statistical significance of differences was determined using the Mann-Whitney test (B and D) or two-way ANOVA (E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent experiments.

    Journal: iScience

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    doi: 10.1016/j.isci.2026.115556

    Figure Lengend Snippet: Tum-CD8 + memory cells express molecules associated with T cell exhaustion Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) The expression of PD-1, TIM-3, CD9, and Gal3 was measured at the surface of CD8 + memory cells at 30 dpi by flow cytometry. (C and D) The expression of Gal3 was measured intracellularly in memory CD8 + T cells at 30 dpi by flow cytometry. (E) At 30 dpi, splenocytes were stimulated with NP68 peptide (10 nM) for 4 h, and the expression of PD-1, TIM-3, or intracellular Gal3 by memory CD8 + T cells was measured by flow cytometry. The statistical significance of differences was determined using the Mann-Whitney test (B and D) or two-way ANOVA (E) (∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent experiments.

    Article Snippet: EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”).

    Techniques: Expressing, Flow Cytometry, MANN-WHITNEY

    Tum-CD8 + memory cells display altered cytokine production but not cytotoxic capacities compared to Vir-CD8 + memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence of GolgiStop. The production of IFNγ, TNF, and IL-2 was measured by flow cytometry and expressed in % of total F5 (A) or MFI within the cytokine+ cells (B). (C and D) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence (cytokines) or absence (CD69) of GolgiStop. The production of IFNγ and TNF and the upregulation of CD69 were measured by flow cytometry over time and expressed in % (C) or MFI (D). (E) The production of IFNγ was measured in supernatant after 4 or 24h of stimulation. (F and G) At 30 dpi, F5 memory cells were restimulated with various doses of NP68 for 4h in the presence of GolgiStop, and the production of IFNγ and TNF was measured by flow cytometry (F). EC 50 was determined (G). (H and I) Splenocytes were incubated with NP68 (10 nM) or control medium for 2h and labeled with CTV or CFSE, respectively. A 1:1 ratio of NP68-loaded splenocytes: control splenocytes (2.10 6 cells) was injected i.v. in Tum-CD8 + or Vir-CD8 + challenged mice at the memory stage. Representative histograms depicting control and CTV-labeled NP68-loaded splenocytes are shown (H). The percentage of NP68-loaded splenocytes killed was evaluated at 6-, 16-, or 44-h post-transfer (I). (J)Total CD8 + enriched from Tum-CD8 + or Vir-CD8 + challenged mice were labeled with CTV and stimulated with NP68-loaded DCs (1:1 ratio) for 4 days in the presence of IL-2. The expansion index of F5 cells was determined after 4 days. The statistical significance of differences was determined using 2-way ANOVA (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent (A–G) or 1 (H–J) experiment(s).

    Journal: iScience

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    doi: 10.1016/j.isci.2026.115556

    Figure Lengend Snippet: Tum-CD8 + memory cells display altered cytokine production but not cytotoxic capacities compared to Vir-CD8 + memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A and B) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence of GolgiStop. The production of IFNγ, TNF, and IL-2 was measured by flow cytometry and expressed in % of total F5 (A) or MFI within the cytokine+ cells (B). (C and D) At 30 dpi, F5 memory cells were restimulated with NP68 (10 nM) for 4h in the presence (cytokines) or absence (CD69) of GolgiStop. The production of IFNγ and TNF and the upregulation of CD69 were measured by flow cytometry over time and expressed in % (C) or MFI (D). (E) The production of IFNγ was measured in supernatant after 4 or 24h of stimulation. (F and G) At 30 dpi, F5 memory cells were restimulated with various doses of NP68 for 4h in the presence of GolgiStop, and the production of IFNγ and TNF was measured by flow cytometry (F). EC 50 was determined (G). (H and I) Splenocytes were incubated with NP68 (10 nM) or control medium for 2h and labeled with CTV or CFSE, respectively. A 1:1 ratio of NP68-loaded splenocytes: control splenocytes (2.10 6 cells) was injected i.v. in Tum-CD8 + or Vir-CD8 + challenged mice at the memory stage. Representative histograms depicting control and CTV-labeled NP68-loaded splenocytes are shown (H). The percentage of NP68-loaded splenocytes killed was evaluated at 6-, 16-, or 44-h post-transfer (I). (J)Total CD8 + enriched from Tum-CD8 + or Vir-CD8 + challenged mice were labeled with CTV and stimulated with NP68-loaded DCs (1:1 ratio) for 4 days in the presence of IL-2. The expansion index of F5 cells was determined after 4 days. The statistical significance of differences was determined using 2-way ANOVA (∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 3 independent (A–G) or 1 (H–J) experiment(s).

    Article Snippet: EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”).

    Techniques: Flow Cytometry, Incubation, Control, Labeling, Injection

    A transient tumoral challenge is sufficient to alter the protection capacity of F5 memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A–D) At 30 dpi, Vir- or Tum-challenged mice were infected with VV-NP68 (2.10 5 pfu). Six days after infection, mice received an i.v. injection of anti-CD8 antibody, and the proportion of cells within the tissue and the vasculature of the lung was determined (A). The proportion of memory CD8 + T cells in the lung tissue among all memory CD8 + T cells was determined (B). The expression of CD49a (C) and CD49d (D) was measured on memory CD8 + T cells within the lung tissue and vasculature. (E) At 30 dpi, Vir- or Tum-challenged mice were infected with Flu-NP68 (5.10 4 TCID50), and the weight loss was followed for 6 days. (F) At 30 dpi, Vir-CD8 + and Tum-CD8 + memory cells were FACS-sorted and transferred into B6 host (1,2.10 5 cells, i.v. route). One day after transfer, mice received a lethal dose of Flu-NP68 (2.10 6 TCID 50), and survival was followed for 10 days. The statistical significance of differences was determined with 1-way (B) or 2-way (C–E) ANOVA test (∗ p > 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001), or log rank test (F). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 (A–D, and G) or 1 (E and F) experiment(s).

    Journal: iScience

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    doi: 10.1016/j.isci.2026.115556

    Figure Lengend Snippet: A transient tumoral challenge is sufficient to alter the protection capacity of F5 memory cells Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). (A–D) At 30 dpi, Vir- or Tum-challenged mice were infected with VV-NP68 (2.10 5 pfu). Six days after infection, mice received an i.v. injection of anti-CD8 antibody, and the proportion of cells within the tissue and the vasculature of the lung was determined (A). The proportion of memory CD8 + T cells in the lung tissue among all memory CD8 + T cells was determined (B). The expression of CD49a (C) and CD49d (D) was measured on memory CD8 + T cells within the lung tissue and vasculature. (E) At 30 dpi, Vir- or Tum-challenged mice were infected with Flu-NP68 (5.10 4 TCID50), and the weight loss was followed for 6 days. (F) At 30 dpi, Vir-CD8 + and Tum-CD8 + memory cells were FACS-sorted and transferred into B6 host (1,2.10 5 cells, i.v. route). One day after transfer, mice received a lethal dose of Flu-NP68 (2.10 6 TCID 50), and survival was followed for 10 days. The statistical significance of differences was determined with 1-way (B) or 2-way (C–E) ANOVA test (∗ p > 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001), or log rank test (F). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 (A–D, and G) or 1 (E and F) experiment(s).

    Article Snippet: EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”).

    Techniques: Infection, Injection, Expressing

    Phenotype and cytokine production capacity of F5 memory cells is conserved after homologous or heterologous recall (A) Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). At 26 dpi, mice received a second immunization with VV-NP68 or EL4-NP68. (B) Thirty-one days post-recall, the number of F5 cells was measured in the spleen. (C) The expression of CD9, CD43, CD49a, and CD49d was measured on F5 memory cells 31 days after recall by flow cytometry. (D and E) Splenocytes were stimulated with NP68 (10 nM) for 4h in the presence (D) or absence (E) of GolgiStop. (D) The production of IFNγ, TFNα, and IL-2 was measured by flow cytometry. (E) The expression of PD-1 and TIM3 on F5 memory cells was determined in the spleen. The statistical significance of differences was determined with 1-way (B and C) or 2-way (D and E) ANOVA test (∗ p > 0.05, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 independent experiments.

    Journal: iScience

    Article Title: Transient tumor exposure induces persistent functional defects in memory CD8 + T cells

    doi: 10.1016/j.isci.2026.115556

    Figure Lengend Snippet: Phenotype and cytokine production capacity of F5 memory cells is conserved after homologous or heterologous recall (A) Naive F5 x CD45.1 cells (2.10 5 ) were i.v. transferred in B6 mice 1-day prior immunization with VV-NP68 (i.n., 2.10 5 pfu) or EL4-NP68 cells (s.c., 2,5.10 6 cells). At 26 dpi, mice received a second immunization with VV-NP68 or EL4-NP68. (B) Thirty-one days post-recall, the number of F5 cells was measured in the spleen. (C) The expression of CD9, CD43, CD49a, and CD49d was measured on F5 memory cells 31 days after recall by flow cytometry. (D and E) Splenocytes were stimulated with NP68 (10 nM) for 4h in the presence (D) or absence (E) of GolgiStop. (D) The production of IFNγ, TFNα, and IL-2 was measured by flow cytometry. (E) The expression of PD-1 and TIM3 on F5 memory cells was determined in the spleen. The statistical significance of differences was determined with 1-way (B and C) or 2-way (D and E) ANOVA test (∗ p > 0.05, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001). Data are represented as mean ± SD ( n = 5 mice per group) and are representative of 2 independent experiments.

    Article Snippet: EL4-NP68 , Dr. T.N.M. Schumacher , Modified from EL4 lymphoma cell line (ATCC “TIB-39”).

    Techniques: Expressing, Flow Cytometry

    Analysis of Eomes expression in CD8 + T cells isolated from the spleens of uninfected WT and Ikzf3 -/- mice. a Representative flow contour plots depicting expression of Eomes in WT and Ikzf3 -/- CD8 + T cells; and b respective bar graphs showing percent (%) of Eomes + and numbers of Eomes-expressing CD8 + T cells (# counts, normalized to 6 × 10 5 events). c Representative histogram overlay for Eomes expression and associated data showing differences in median fluorescence intensity (MFI) fold change relative to WT control. For ( a – c ), data shown for 4 independent experiments, n = 14/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. d Representative flow plots and e associated bar graphs showing percent (%) of CD122 + and numbers of CD122-expressing CD8 + T cells (#: counts, normalized to 6 × 10 5 events), Data shown for 3 independent experiments, n = 11/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. f Analysis of publicly available Aiolos Chromatin Immunoprecipitation (ChIP)-Seq data (GSM5106065) and STAT5b ChIP-Seq data (GSM7887512) showing enrichment of Aiolos and STAT5b at the Eomes promoter region. Sequencing tracks were viewed using Integrative Genomics Viewer. The gene region cloned into a reporter vector for Eomes promoter activity is indicated. g , h EL4 T cells were transfected with an Eomes promoter-reporter construct in conjunction with vectors for Aiolos, Aiolos DNA binding mutant (Aiolos DBM) , constitutively active STAT5b (STAT5b CA ), or empty vector control. As a control for transfection efficiency, cells were concurrently transfected with SV40- Renilla , and luciferase activity was used as a readout for promoter activity. Luciferase promoter-reporter values were normalized to SV40- Renilla control and presented as relative to the empty vector. Immunoblot analysis of the indicated proteins confirming the overexpression of respective vectors. β-actin was used as a loading control. Data are representative of 4 independent experiments, n = 4/condition, mean ± SEM, one-way ANOVA with Tukey’s multiple comparisons test, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Source data are provided as a file.

    Journal: Nature Communications

    Article Title: Aiolos restricts the generation of antigen-inexperienced, virtual memory CD8 + T cells in mice

    doi: 10.1038/s41467-025-67540-8

    Figure Lengend Snippet: Analysis of Eomes expression in CD8 + T cells isolated from the spleens of uninfected WT and Ikzf3 -/- mice. a Representative flow contour plots depicting expression of Eomes in WT and Ikzf3 -/- CD8 + T cells; and b respective bar graphs showing percent (%) of Eomes + and numbers of Eomes-expressing CD8 + T cells (# counts, normalized to 6 × 10 5 events). c Representative histogram overlay for Eomes expression and associated data showing differences in median fluorescence intensity (MFI) fold change relative to WT control. For ( a – c ), data shown for 4 independent experiments, n = 14/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. d Representative flow plots and e associated bar graphs showing percent (%) of CD122 + and numbers of CD122-expressing CD8 + T cells (#: counts, normalized to 6 × 10 5 events), Data shown for 3 independent experiments, n = 11/group, mean ± SEM, two-sided, unpaired Student’s t-test, ****p ≤ 0.0001. f Analysis of publicly available Aiolos Chromatin Immunoprecipitation (ChIP)-Seq data (GSM5106065) and STAT5b ChIP-Seq data (GSM7887512) showing enrichment of Aiolos and STAT5b at the Eomes promoter region. Sequencing tracks were viewed using Integrative Genomics Viewer. The gene region cloned into a reporter vector for Eomes promoter activity is indicated. g , h EL4 T cells were transfected with an Eomes promoter-reporter construct in conjunction with vectors for Aiolos, Aiolos DNA binding mutant (Aiolos DBM) , constitutively active STAT5b (STAT5b CA ), or empty vector control. As a control for transfection efficiency, cells were concurrently transfected with SV40- Renilla , and luciferase activity was used as a readout for promoter activity. Luciferase promoter-reporter values were normalized to SV40- Renilla control and presented as relative to the empty vector. Immunoblot analysis of the indicated proteins confirming the overexpression of respective vectors. β-actin was used as a loading control. Data are representative of 4 independent experiments, n = 4/condition, mean ± SEM, one-way ANOVA with Tukey’s multiple comparisons test, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001. Source data are provided as a file.

    Article Snippet: The EL4 murine T cell lymphoma line (TIB-39) for transfection studies and YAC-1 cells (TIB-160) for cytotoxicity were acquired from the American Type Culture Collection (ATCC) and maintained in complete RPMI (RPMI media [catalog # 61870-036, Thermo Fisher Scientific] containing 10% FBS [catalog # 26140-079, Life Technologies] and 1% penicillin/streptomycin [catalog # 15140-122, Life Technologies]).

    Techniques: Expressing, Isolation, Fluorescence, Control, Chromatin Immunoprecipitation, ChIP-sequencing, Sequencing, Clone Assay, Plasmid Preparation, Activity Assay, Transfection, Construct, Binding Assay, Mutagenesis, Luciferase, Western Blot, Over Expression

    A ) CD45.1 mice were adoptively transferred with 1–2 × 10 5 gp100+ CD8 T cells co-transduced −CA-STAT5 or +CA-STAT5 and vaccinated with TriVax on the following day (n=3 mice/group). 7 days later, the mice were sacrificed and splenocytes were harvested for cytokine analysis. B ) Representative images demonstrating the percentage of splenocytes producing IFNγ, TNFα, and Granzyme B (GzmB) in response to gp100 peptide stimulation compared to irrelevant (ova) peptide. The number of cells from each group incubated with peptide were normalized based on tetramer staining so that each well had the same number of gp100 tetramer+ T cells. Summary of results depicted in bar graph. C ) Measurement of IFNγ production in an ELISpot assay. The number of CD8 T cells in each group per well were unsorted and normalized to the same number of total gp100 tetramer+ CD8 T cells so that each well had the same number of gp100+ CD8 T cells. D ) CD8 T cells isolated from the experiments described in A were co-cultured with EL4, EL4 pulsed with gp100 short peptide (positive control), or B16F10 tumor cells. Supernatant was harvested after overnight culture from triplicate wells and evaluated for IFNγ production using ELISA. E ) Cytotoxic killing potential was measured by co-culturing +CA-STAT5 or −CA-STAT5 CD8 T cells with CFSE-labeled EL4, EL4 pulsed with gp100 short peptide, or B16F10 at an effector-to-target ratio (gp100 tetramer+ CD8 T cells to B16 melanoma) of 10:1. Summary graphs of at least two independent experiments from each figure is shown.

    Journal: Molecular cancer therapeutics

    Article Title: STAT5 activation enhances adoptive therapy combined with peptide vaccination by preventing PD-1 inhibition

    doi: 10.1158/1535-7163.MCT-24-0505

    Figure Lengend Snippet: A ) CD45.1 mice were adoptively transferred with 1–2 × 10 5 gp100+ CD8 T cells co-transduced −CA-STAT5 or +CA-STAT5 and vaccinated with TriVax on the following day (n=3 mice/group). 7 days later, the mice were sacrificed and splenocytes were harvested for cytokine analysis. B ) Representative images demonstrating the percentage of splenocytes producing IFNγ, TNFα, and Granzyme B (GzmB) in response to gp100 peptide stimulation compared to irrelevant (ova) peptide. The number of cells from each group incubated with peptide were normalized based on tetramer staining so that each well had the same number of gp100 tetramer+ T cells. Summary of results depicted in bar graph. C ) Measurement of IFNγ production in an ELISpot assay. The number of CD8 T cells in each group per well were unsorted and normalized to the same number of total gp100 tetramer+ CD8 T cells so that each well had the same number of gp100+ CD8 T cells. D ) CD8 T cells isolated from the experiments described in A were co-cultured with EL4, EL4 pulsed with gp100 short peptide (positive control), or B16F10 tumor cells. Supernatant was harvested after overnight culture from triplicate wells and evaluated for IFNγ production using ELISA. E ) Cytotoxic killing potential was measured by co-culturing +CA-STAT5 or −CA-STAT5 CD8 T cells with CFSE-labeled EL4, EL4 pulsed with gp100 short peptide, or B16F10 at an effector-to-target ratio (gp100 tetramer+ CD8 T cells to B16 melanoma) of 10:1. Summary graphs of at least two independent experiments from each figure is shown.

    Article Snippet: Mouse lymphoma cell line EL4 expressing mouse MHC-I (Db/Kb) was purchased from the American Type Culture Collection (2015) and maintained as recommended by the vendor.

    Techniques: Incubation, Staining, Enzyme-linked Immunospot, Isolation, Cell Culture, Positive Control, Enzyme-linked Immunosorbent Assay, Labeling

    a , b The log2 ratio of gene abundance between the memory and naïve OT-I cells, line plot with genes ranked according to increasing log2 ratios. Based on data from Fig. ( a ) and GEO dataset GSE15907 ( b ). c H2A.Z expression was analyzed in naïve (CD62L hi CD44 lo ) and memory (CD127 hi KLRG1 lo ) OT-I cells ( n = 5 mice per group). Values denote geometric mean fluorescence intensity (gMFI). d Experiment setup. CD45 congenically distinct naïve OT-I cells from wild-type (WT) and GzmB-Cre H2A.Z f/f (cKO) OT-I mice were mixed at a 1:1 ratio and co-transferred into recipients. On the next day, these mice were infected with LM-OVA. On day 30-45, WT and cKO memory OT-I cells were sorted and re-mixed at a 1:1 ratio (1.5 × 10 4 mixed cells/mice) and co-transferred into congenically marked WT recipients and followed by LM-OVA infection. e At day 7 post-infection, the frequencies of donor cells in the spleen of recipient mice were determined ( n = 10 mice). f Experiment setup. CD45 congenically distinct naïve OT-I cells from WT and Rosa26 cre-ERT2 H2A.Z f/f (icKO) OT-I mice were mixed at a 1:1 ratio and transferred into recipients. On the next day, these mice were infected with LM-OVA. After TAM injection, WT and icKO memory OT-I cells were sorted and re-transferred into congenically marked WT recipients and followed by LM-OVA infection. g , h On day 7 post-infection, the frequencies of donor cells in the blood ( g ) and spleen ( h ) of recipient mice were determined ( n = 10 mice). i , j Splenocytes isolated from recipient mice were stimulated with the OVA 257-264 peptide for 6 h, then cytokine production from OT-I cells was measured. Values denote gMFI ( n = 9 biologically independent samples). Data are representative of two independent experiments in ( c ), three independent experiments in ( e and g – j ). Data are mean ± SD. Statistical analysis was performed using two-tailed unpaired Student’s t test ( c ) or two-tailed paired Student’s t test ( e and g – j ). Source data are provided as a file.

    Journal: Nature Communications

    Article Title: H2A.Z primes an epigenetic landscape for memory CD8 + T cell recall response

    doi: 10.1038/s41467-025-62976-4

    Figure Lengend Snippet: a , b The log2 ratio of gene abundance between the memory and naïve OT-I cells, line plot with genes ranked according to increasing log2 ratios. Based on data from Fig. ( a ) and GEO dataset GSE15907 ( b ). c H2A.Z expression was analyzed in naïve (CD62L hi CD44 lo ) and memory (CD127 hi KLRG1 lo ) OT-I cells ( n = 5 mice per group). Values denote geometric mean fluorescence intensity (gMFI). d Experiment setup. CD45 congenically distinct naïve OT-I cells from wild-type (WT) and GzmB-Cre H2A.Z f/f (cKO) OT-I mice were mixed at a 1:1 ratio and co-transferred into recipients. On the next day, these mice were infected with LM-OVA. On day 30-45, WT and cKO memory OT-I cells were sorted and re-mixed at a 1:1 ratio (1.5 × 10 4 mixed cells/mice) and co-transferred into congenically marked WT recipients and followed by LM-OVA infection. e At day 7 post-infection, the frequencies of donor cells in the spleen of recipient mice were determined ( n = 10 mice). f Experiment setup. CD45 congenically distinct naïve OT-I cells from WT and Rosa26 cre-ERT2 H2A.Z f/f (icKO) OT-I mice were mixed at a 1:1 ratio and transferred into recipients. On the next day, these mice were infected with LM-OVA. After TAM injection, WT and icKO memory OT-I cells were sorted and re-transferred into congenically marked WT recipients and followed by LM-OVA infection. g , h On day 7 post-infection, the frequencies of donor cells in the blood ( g ) and spleen ( h ) of recipient mice were determined ( n = 10 mice). i , j Splenocytes isolated from recipient mice were stimulated with the OVA 257-264 peptide for 6 h, then cytokine production from OT-I cells was measured. Values denote gMFI ( n = 9 biologically independent samples). Data are representative of two independent experiments in ( c ), three independent experiments in ( e and g – j ). Data are mean ± SD. Statistical analysis was performed using two-tailed unpaired Student’s t test ( c ) or two-tailed paired Student’s t test ( e and g – j ). Source data are provided as a file.

    Article Snippet: EL-4 mouse lymphoma cell line (ATCC) and Phoenix-ECO cells (ATCC) were maintained in DMEM containing 10% fetal bovine serum, 10 mM Hepes and 1% penicillin/streptomycin.

    Techniques: Expressing, Fluorescence, Infection, Injection, Isolation, Two Tailed Test